|
|
Supplementary MaterialWorm Culture Wild type C. elegans N2 worms were grown on "Special" NGM plates supplemented to 2.5% agar and 1% peptone. After consuming the OP50 bacterial lawn on the plate, they were fed concentrated bacteria until they reached the adult stage. They were then rinsed off the plates and filtered sequentially through 40 micron and 20 micron mesh nylon. This dispersed any contaminating bacteria and selected for gravid adults. The two filtrates were rinsed into a 50 ml centrifuge tube, spun at 750g in an IEC clinical centrifuge for 60 seconds, and the supernatant aspirated. The tube was filled with a solution of 0.5NKOH, 0.8-1.2% NaOCl (1:5 dilution of sodium hypochlorite) and vortexed for one minute, then spun immediately at 750g for 30 seconds. The supernatant was aspirated and 25 ml of fresh hypochlorite solution added. The mixture was vortexed one minute, then the tube was filled with ice cold M9 and spun for 30 seconds. The supernatant was aspirated and the pellet was washed 3 more times (50 ml ice cold M9 each time, vortexing well and spinning quickly). The final pellet was dispersed by vortexing in S basal then put into 100mM petri dishes (10-15 ml liquid /plate; about 10 ml S basal/0.1 ml eggs). The eggs were hatched in the petri dishes in S basal overnight, with swirling. The L1 larva were spun down and placed on Special NGM plates until they reached the appropriate stage as determined by Nomarski microscopy. They were floated off the plates in water and rinsed three times by spinning at 400g in an IEC clinical centrifuge to remove bacteria. The worm pellets were quick-frozen in liquid nitrogen and stored at -80°C before extraction of the RNA. Dicer deficient animals were obtained by enriching for dcr-1(ok247) animals from among the progeny of dcr-1(ok247)/qC1 hermaphrodites (6). A recessive ivermectin-resistance marker was incuded in cis to the ok247 allele (A Grishok and C. Mello, personal communication). Gravid hermaphrodites of the above heterozygous genotype were harvested, and eggs were isolated by hypochlorite treatment, as described above. Hatched L1 larvae were placed on paltes with food and 20 ng/ml ivermectin and 1% DMSO. After 4 days of growth, the homozygous dcr-1(ok247) animals were enriched in the population owing to their ivermectin resistance. RNA extraction All centrifugation was done in a Sorvall RC5B for 10 minutes at 10K RPM, 4°C, in a SS34 rotor.
Four volumes of Gibco Trizol were added to a frozen pellet of worms and vortexed for 15 minutes. Chloroform was added to 0.85× of the pellet volume, the mixture was vortexed for 1 minute, and centrifuged. The aqueous phase was placed in a clean tube with an equal volume of phenol /chloroform (50/50) and vortexed for 2 minutes, then centrifuged. The aqueous phase was placed in a clean tube and precipitated by addition of one volume of isopropanol and chilling on ice for ten minutes. The RNA precipitate was recovered by centrifugation; the pellet was then rinsed with 70% ethanol/water, air dried, and then dissolved in 0.5ml of TES (10 mM Tris pH 8.0, EDTA 1 mM, 1% SDS). 2 ml Trizol was added and the pellet was vortexed (with heating, if required) until completely dissolved. 425 cDNA library preparation Total RNA was prepared from mixed-stage populations of C. elegans as described above, and dissolved in denaturing buffer (either 8M urea 20 mM phosphate, pH 6.8, or 70% formamide) at a concentration of approximately 5 mg/ml. Each 200 microliter portion of the RNA sample was centrifuged through a 0.5 ml Centrex 100 column (Schleicher and Schuell) according to the manufacturers instructions. Columns were washed by a second spin with an equal volume of fresh solute, and eluates (enriched for RNAs shorter than approximately 100nt) were pooled. Small RNAs were recovered from this enriched fraction by isopropanol precipitation, followed by electrophoresis through a denaturing 12% acrylamide gel. Material in the 20-25 nt range was excised from the gel and the RNA was eluted with 0.5 M NaAcetate10mM EDTA at room temperature for 12 hours. The eluate was extracted with chloroform to remove gel residue, and the RNA was recovered by ethanol precipitation with 40 micrograms of glycogen, dissolved in 20 microliters of water and stored at -80°C. The small RNA sample was then treated with Calf Alkaline Phosphate (CIP) (New England Biolabs), extracted with phenol/chloroform, and precipitated with ethanol. The CIP-treated RNA was ligated to oligonucleotide "Achimera" (3'p-rA6A24) in 100 microliters of: 50 mM tris pH 7.5, 20 mM MgCl, 3.3 mM DTT, 6 mM ATP, 0.001% BSA, 10% DMSO, 50 U T4 RNA ligase (Amersham) 5°C 12-24 hours. The ligation product (consisting of Achimera ligated to the 3' ends of the sample RNAs; about 50-55 nt), was recovered by size selection using an acrylamide gel as above. This artificially-polyadenylated small RNA sample was used for RT/PCR cDNA synthesis and cloning using the Clontech SMART cloning kit and lambda Triplex2 vector (Clontech). The unamplified version of this library (0501A_Ce22.1) contained about 1.6 × 106 independent clones. The library was amplified (to about 1010 pfu/ml) and stored at -80°C. DNA sequencing cDNA clones were sequenced from the unamplified library by two methods: Approximately 200 sequences were obtained by picking individual plaques into10 mM MgCl2, amplifying the insert sequence with Clontech 5´ and 3´ primers, and sequencing using ABI BigDye and a nested primer. The remainder of the sequences were obtained by converting the lambdaTriplex2 phage into pTriplex2 plasmid using the Clonetech instructions, and sequencing plasmid DNA. Plasmid sequencing was performed by Agencourt, Inc of Beverly MA. Informatics Approximately 10% of the C. briggsae genome had been analyzed for C. elegans alignment by WJ Kemp and deposited by Kemp on the intronerator Web site [W. J. Kent and A. M. Zahler, Genome Res. 10, 1115 (2000)] http://www.cse.ucsc.edu/~kent/intronerator/. From this sample, 4600 sequences with strong C. briggsae::C. elegans alignments of at least 40 nucleotide were obtained. C. elegans genomic segments were tested for predicted RNA secondary structure using Michael Zuker's mfold [D. H. Mathews, J. Sabina, M. Zuker, D. H. Turner, J. Mol. Biol. 288, 911 (1999)] Web server http://bioinfo.math.rpi.edu/~mfold/rna/form1.cgi. Each strand was folded individually, in 40-199 nucleotide segments). The output was scanned by eye for stem-loops. The corresponding sequences were tested by BLAST to C. elegans genome and the 40 best stems corresponding to non-repetitive sequences were tested for expression by Northern blots. Probes were radiolabeled oligonucleotides complementary to the 5´ half of the stem (up to the predicted loop) of each of the 40 finalists. Northern blot analysis. RNA samples were run on 12% or 15% acrylamide denaturing (urea) gels and then transferred to Zeta-Probe GT membranes by electrophoresis. After transfer, they were crosslinked with 120mjoules of UV and baked at 80°C for 1 hour. Oligonucleotide probes were labeled using Integrated DNA Technologies' Starfire Oligos Kit and Amersham cat #PB10474 alpha-32P ATP and hybridized to the membranes at 42°C in 7% SDS, 0.2M Na2PO4 pH7.0 overnight. Membranes were washed at 42°C, twice with 2×SSPE, 0.1% SDS and twice with 0.5× SSPE, 0.1% SDS. The blots were exposed on Molecular Dynamics Phosphorimager screens and signals were quantified using ImageQuant (Molecular Dynamics). Oligonucleotide probes: In bold are the probes that detect a ~22 nt transcript.
mir-1_5' ATAGTATGGGCATGTAAGGAAGTATGCAGCTCGG
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
l of chloroform was added, the solution was vortexed two minutes then centrifuged. The aqueous phase was removed and placed in a clean tube with an equal volume of phenol/chloroform, vortexed, and centrifuged. The aqueous phase was removed and placed in a clean tube, one-tenth volume of 3M Sodium Acetate was added, followed by one volume of isopropanol. After chilling on ice for an hour, the precipitate was recovered by centrifugation. The pellet was washed with 70% ethanol, air dried and dissolved in 1 ml of TE (10 MM Tris pH 8.0, 1 mM EDTA). Phenol/ chloroform extractions were then repeated until no interface remained after centrifugation. The aqueous phase was then extracted with an equal volume of chloroform, and precipitated by adding one-tenth volume 3M Sodium Acetate, and 3 volumes of ethanol. After spinning, the pellet was rinsed in 70% ethanol, dried and resuspended in TE or water and stored at -80°C.Science. ISSN 0036-8075 (print), 1095-9203 (online)
Magazine | News | Signaling | Careers | Multimedia | Collections | Help | Site Map | RSS
Subscribe | Feedback | Privacy / Legal | About Us | Advertise With Us | Contact Us
© 2009 American Association for the Advancement of Science. All Rights Reserved.
AAAS is a partner of HINARI, AGORA, PatientInform, CrossRef, and COUNTER.
You have reached the bottom of the page. Back to top